Review



rabbit anti p perk polyclonal antibody abmart  (Abmart Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Abmart Inc rabbit anti p perk polyclonal antibody abmart
    Rabbit Anti P Perk Polyclonal Antibody Abmart, supplied by Abmart Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+perk+polyclonal+antibody+abmart/antibody+polyclonal+rabbit/pm41588458-412-55-59
    Average 86 stars, based on 1 article reviews
    rabbit anti p perk polyclonal antibody abmart - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Control:

    Article Title: Outer membrane vesicles secreted by avian pathogenic Escherichia coli promote its survival within macrophages and systemic infection by inducing endoplasmic reticulum stress-mediated autophagy flux blockade.
    Article Snippet: .. Poult Sci 103: 104359 AR TIC LE IN PR ES S mouse anti-OmpA polyclonal antibody the Anhui Provincial Key Laboratory of Veterinary Pathology and Disease Prevention and Control, Anhui, China 1:500 rabbit anti-OmpF polyclonal antibody Biorbyt, Cambridge, UK 1:500 rabbit anti-GRP78/Bip polyclonal antibody Abmart, Shanghai, China 1:5000 rabbit anti-PERK polyclonal antibody Abmart, Shanghai, China 1:5000 rabbit anti-p-PERK polyclonal antibody Abmart, Shanghai, China 1:5000 rabbit anti-elF2α polyclonal antibody Proteintech, Hubei, China 1:2000 rabbit anti-p-elF2α polyclonal antibody Proteintech, Hubei, China 1:2000 rabbit anti-CHOP polyclonal antibody Abmart, Shanghai, China 1:5000 rabbit anti-IRE1 polyclonal antibody Abmart, Shanghai, China 1:5000 rabbit anti-p-IRE1 polyclonal antibody Abmart, Shanghai, China 1:5000 rabbit anti- ATF6 polyclonal antibody Boster, Hubei, China 1:2000 rabbit anti-LC3B polyclonal antibody Proteintech, Hubei, China 1:3000 rabbit anti-p62/SQSTM1 polyclonal antibody Proteintech, Hubei, China 1:20000 rabbit anti-Beclin1 polyclonal antibody Bioss, Beijing, China 1:2000 mouse anti-LAMP1 monoclonal Antibody Zenbio, Sichuan, China 1:300 goat anti-rabbit horseradish peroxidase-labeled antibody Zenbio, Sichuan, China 1:1000 goat anti-mouse horseradish peroxidase-labeled antibody Zenbio, Sichuan, China 1:1000 FITC-labeled goat anti-rabbit IgG (H+L) Beyotime, Shanghai, China 1:500 Cy3-labeled goat anti-mouse IgG (H+L) Beyotime, Shanghai, China 1:500 4-Phenylbutyric acid (4-PBA) MedChemExpress, Shanghai, China 2 mM CQ MedChemExpress, Shanghai, China 10 μM Mito-TEMPO MedChemExpress, Shanghai, China 10 μM Bafilomycin A1 (BafA1) MedChemExpress, Shanghai, China 100 nM AR TIC LE IN PR ES S ERdj4-F ERdj4-R TGACCGCCAGATCAAGAAGG GCCCGGAACAGTCTGTGTAT 651 bp AR TIC LE IN PR ES S AR TIC LE IN PR ES S AR TIC LE IN PR ES S AR TIC LE IN PR ES S AR TIC LE IN PR ES S AR TIC LE IN PR ES S AR TIC LE IN PR ES S AR TIC LE IN PR ES S ..



    Similar Products

    86
    Abmart Inc rabbit anti p perk polyclonal antibody abmart
    Rabbit Anti P Perk Polyclonal Antibody Abmart, supplied by Abmart Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+perk+polyclonal+antibody+abmart/antibody+polyclonal+rabbit/pm41588458-412-55-59
    Average 86 stars, based on 1 article reviews
    rabbit anti p perk polyclonal antibody abmart - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    86
    Abmart Inc rabbit anti perk polyclonal antibody abmart
    Rabbit Anti Perk Polyclonal Antibody Abmart, supplied by Abmart Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+anti+perk+polyclonal+antibody+abmart/antibody+polyclonal+rabbit/pm41588458-412-47-51
    Average 86 stars, based on 1 article reviews
    rabbit anti perk polyclonal antibody abmart - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    Image Search Results